CRISPR comparison
Your file must look exactly like the example below (except for the sequences, of course).
Spacer name structure is highly important. The order of spacers is not important.
>spacer1
AGTACTCTATCGATCGTAGCTAGCTAGCTAGC
>spacer2
TTGCATCGATGGCTAGCTTAGCGTAGCGAGGG
...
Upload fasta file with spacers:
Or input you CRISPR here
Enter percent of mismatches allowed from 0 to 1. (optional) (default is 0.13, which stands for about 3 mismatches per usual spacer)
Enter CRISPR name (optional)
Enter CRISPR spacers